Review





Similar Products

99
ATCC human androgen receptor independent prostate cancer aripc cell lines du145
Depletion of ACACA promotes inflammation in ARIPC cells. ( A-B ) Inflammatory pathways significantly enriched in ACACA-depleted ARIPC cells. ( C-D ) GSEA showed that the ‘Regulation of inflammatory response’ was activated in ACACA-depleted ARIPC cells on the basis of the transcriptome data. ( E-F ) Heatmap of inflammatory biomarker-related gene expression in ACACA-depleted ARIPC cells on the basis of transcriptome data. ( G ) Quantification of the qPCR analysis results of inflammation biomarker-related gene expression in ACACA depleted <t>DU145</t> cells. ( H ) Quantification of qPCR analysis results of inflammation biomarker-related gene expression in DU145 cells after TOFA treatment (10 µg/mL, 72 h). Data are represented as mean ± SD in ( G and H ). * P < 0.05
Human Androgen Receptor Independent Prostate Cancer Aripc Cell Lines Du145, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+androgen+receptor/pmc12291313-35-1-35?v=ATCC
Average 99 stars, based on 1 article reviews
human androgen receptor independent prostate cancer aripc cell lines du145 - by Bioz Stars, 2026-07
99/100 stars
  Buy from Supplier

93
OriGene flag tagged wt ar
Depletion of ACACA promotes inflammation in ARIPC cells. ( A-B ) Inflammatory pathways significantly enriched in ACACA-depleted ARIPC cells. ( C-D ) GSEA showed that the ‘Regulation of inflammatory response’ was activated in ACACA-depleted ARIPC cells on the basis of the transcriptome data. ( E-F ) Heatmap of inflammatory biomarker-related gene expression in ACACA-depleted ARIPC cells on the basis of transcriptome data. ( G ) Quantification of the qPCR analysis results of inflammation biomarker-related gene expression in ACACA depleted <t>DU145</t> cells. ( H ) Quantification of qPCR analysis results of inflammation biomarker-related gene expression in DU145 cells after TOFA treatment (10 µg/mL, 72 h). Data are represented as mean ± SD in ( G and H ). * P < 0.05
Flag Tagged Wt Ar, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+androgen+receptor/pm40490871-212-9-12?v=OriGene
Average 93 stars, based on 1 article reviews
flag tagged wt ar - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

93
OriGene androgen receptor ar
Depletion of ACACA promotes inflammation in ARIPC cells. ( A-B ) Inflammatory pathways significantly enriched in ACACA-depleted ARIPC cells. ( C-D ) GSEA showed that the ‘Regulation of inflammatory response’ was activated in ACACA-depleted ARIPC cells on the basis of the transcriptome data. ( E-F ) Heatmap of inflammatory biomarker-related gene expression in ACACA-depleted ARIPC cells on the basis of transcriptome data. ( G ) Quantification of the qPCR analysis results of inflammation biomarker-related gene expression in ACACA depleted <t>DU145</t> cells. ( H ) Quantification of qPCR analysis results of inflammation biomarker-related gene expression in DU145 cells after TOFA treatment (10 µg/mL, 72 h). Data are represented as mean ± SD in ( G and H ). * P < 0.05
Androgen Receptor Ar, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+androgen+receptor/pmc12125945-53-0-13?v=OriGene
Average 93 stars, based on 1 article reviews
androgen receptor ar - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

90
INDIGO Biosciences human androgen receptor (nr3c4, ar) assay system
Depletion of ACACA promotes inflammation in ARIPC cells. ( A-B ) Inflammatory pathways significantly enriched in ACACA-depleted ARIPC cells. ( C-D ) GSEA showed that the ‘Regulation of inflammatory response’ was activated in ACACA-depleted ARIPC cells on the basis of the transcriptome data. ( E-F ) Heatmap of inflammatory biomarker-related gene expression in ACACA-depleted ARIPC cells on the basis of transcriptome data. ( G ) Quantification of the qPCR analysis results of inflammation biomarker-related gene expression in ACACA depleted <t>DU145</t> cells. ( H ) Quantification of qPCR analysis results of inflammation biomarker-related gene expression in DU145 cells after TOFA treatment (10 µg/mL, 72 h). Data are represented as mean ± SD in ( G and H ). * P < 0.05
Human Androgen Receptor (Nr3c4, Ar) Assay System, supplied by INDIGO Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+androgen+receptor/pm40239649-477-74-85?v=INDIGO+Biosciences
Average 90 stars, based on 1 article reviews
human androgen receptor (nr3c4, ar) assay system - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Brinkmann Instruments human androgen receptor
Depletion of ACACA promotes inflammation in ARIPC cells. ( A-B ) Inflammatory pathways significantly enriched in ACACA-depleted ARIPC cells. ( C-D ) GSEA showed that the ‘Regulation of inflammatory response’ was activated in ACACA-depleted ARIPC cells on the basis of the transcriptome data. ( E-F ) Heatmap of inflammatory biomarker-related gene expression in ACACA-depleted ARIPC cells on the basis of transcriptome data. ( G ) Quantification of the qPCR analysis results of inflammation biomarker-related gene expression in ACACA depleted <t>DU145</t> cells. ( H ) Quantification of qPCR analysis results of inflammation biomarker-related gene expression in DU145 cells after TOFA treatment (10 µg/mL, 72 h). Data are represented as mean ± SD in ( G and H ). * P < 0.05
Human Androgen Receptor, supplied by Brinkmann Instruments, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+androgen+receptor/pm40231807-442-27-21?v=Brinkmann+Instruments
Average 90 stars, based on 1 article reviews
human androgen receptor - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

96
Cell Signaling Technology Inc human ar
Depletion of ACACA promotes inflammation in ARIPC cells. ( A-B ) Inflammatory pathways significantly enriched in ACACA-depleted ARIPC cells. ( C-D ) GSEA showed that the ‘Regulation of inflammatory response’ was activated in ACACA-depleted ARIPC cells on the basis of the transcriptome data. ( E-F ) Heatmap of inflammatory biomarker-related gene expression in ACACA-depleted ARIPC cells on the basis of transcriptome data. ( G ) Quantification of the qPCR analysis results of inflammation biomarker-related gene expression in ACACA depleted <t>DU145</t> cells. ( H ) Quantification of qPCR analysis results of inflammation biomarker-related gene expression in DU145 cells after TOFA treatment (10 µg/mL, 72 h). Data are represented as mean ± SD in ( G and H ). * P < 0.05
Human Ar, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+androgen+receptor/pm40265585-785-6-11?v=Cell+Signaling+Technology+Inc
Average 96 stars, based on 1 article reviews
human ar - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

92
OriGene paper n a mouse ar region 2 ar2 rp gatatatgcccaggagaggtattg
Depletion of ACACA promotes inflammation in ARIPC cells. ( A-B ) Inflammatory pathways significantly enriched in ACACA-depleted ARIPC cells. ( C-D ) GSEA showed that the ‘Regulation of inflammatory response’ was activated in ACACA-depleted ARIPC cells on the basis of the transcriptome data. ( E-F ) Heatmap of inflammatory biomarker-related gene expression in ACACA-depleted ARIPC cells on the basis of transcriptome data. ( G ) Quantification of the qPCR analysis results of inflammation biomarker-related gene expression in ACACA depleted <t>DU145</t> cells. ( H ) Quantification of qPCR analysis results of inflammation biomarker-related gene expression in DU145 cells after TOFA treatment (10 µg/mL, 72 h). Data are represented as mean ± SD in ( G and H ). * P < 0.05
Paper N A Mouse Ar Region 2 Ar2 Rp Gatatatgcccaggagaggtattg, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+androgen+receptor/pmc11224269__41467_2024_49978_MOESM1_ESM-130-174-191?v=OriGene
Average 92 stars, based on 1 article reviews
paper n a mouse ar region 2 ar2 rp gatatatgcccaggagaggtattg - by Bioz Stars, 2026-07
92/100 stars
  Buy from Supplier

90
Cell Signaling Technology Inc rabbit anti-human androgen receptor (ar; 1:1,000 in 5% bsa) (d6f11)
Depletion of ACACA promotes inflammation in ARIPC cells. ( A-B ) Inflammatory pathways significantly enriched in ACACA-depleted ARIPC cells. ( C-D ) GSEA showed that the ‘Regulation of inflammatory response’ was activated in ACACA-depleted ARIPC cells on the basis of the transcriptome data. ( E-F ) Heatmap of inflammatory biomarker-related gene expression in ACACA-depleted ARIPC cells on the basis of transcriptome data. ( G ) Quantification of the qPCR analysis results of inflammation biomarker-related gene expression in ACACA depleted <t>DU145</t> cells. ( H ) Quantification of qPCR analysis results of inflammation biomarker-related gene expression in DU145 cells after TOFA treatment (10 µg/mL, 72 h). Data are represented as mean ± SD in ( G and H ). * P < 0.05
Rabbit Anti Human Androgen Receptor (Ar; 1:1,000 In 5% Bsa) (D6f11), supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+androgen+receptor/10__1249_slash_mss__0000000000003509-151-91-92?v=Cell+Signaling+Technology+Inc
Average 90 stars, based on 1 article reviews
rabbit anti-human androgen receptor (ar; 1:1,000 in 5% bsa) (d6f11) - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

93
Cell Signaling Technology Inc rabbit anti human androgen receptor
Depletion of ACACA promotes inflammation in ARIPC cells. ( A-B ) Inflammatory pathways significantly enriched in ACACA-depleted ARIPC cells. ( C-D ) GSEA showed that the ‘Regulation of inflammatory response’ was activated in ACACA-depleted ARIPC cells on the basis of the transcriptome data. ( E-F ) Heatmap of inflammatory biomarker-related gene expression in ACACA-depleted ARIPC cells on the basis of transcriptome data. ( G ) Quantification of the qPCR analysis results of inflammation biomarker-related gene expression in ACACA depleted <t>DU145</t> cells. ( H ) Quantification of qPCR analysis results of inflammation biomarker-related gene expression in DU145 cells after TOFA treatment (10 µg/mL, 72 h). Data are represented as mean ± SD in ( G and H ). * P < 0.05
Rabbit Anti Human Androgen Receptor, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+androgen+receptor/10__1249_slash_mss__0000000000003509-151-82-92?v=Cell+Signaling+Technology+Inc
Average 93 stars, based on 1 article reviews
rabbit anti human androgen receptor - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

90
Databank Inc 3d structure of the human androgen receptor ligand binding
Depletion of ACACA promotes inflammation in ARIPC cells. ( A-B ) Inflammatory pathways significantly enriched in ACACA-depleted ARIPC cells. ( C-D ) GSEA showed that the ‘Regulation of inflammatory response’ was activated in ACACA-depleted ARIPC cells on the basis of the transcriptome data. ( E-F ) Heatmap of inflammatory biomarker-related gene expression in ACACA-depleted ARIPC cells on the basis of transcriptome data. ( G ) Quantification of the qPCR analysis results of inflammation biomarker-related gene expression in ACACA depleted <t>DU145</t> cells. ( H ) Quantification of qPCR analysis results of inflammation biomarker-related gene expression in DU145 cells after TOFA treatment (10 µg/mL, 72 h). Data are represented as mean ± SD in ( G and H ). * P < 0.05
3d Structure Of The Human Androgen Receptor Ligand Binding, supplied by Databank Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+androgen+receptor/10__62110_slash_sciencein__jmc__2024__685-38-4-17?v=Databank+Inc
Average 90 stars, based on 1 article reviews
3d structure of the human androgen receptor ligand binding - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

Image Search Results


Depletion of ACACA promotes inflammation in ARIPC cells. ( A-B ) Inflammatory pathways significantly enriched in ACACA-depleted ARIPC cells. ( C-D ) GSEA showed that the ‘Regulation of inflammatory response’ was activated in ACACA-depleted ARIPC cells on the basis of the transcriptome data. ( E-F ) Heatmap of inflammatory biomarker-related gene expression in ACACA-depleted ARIPC cells on the basis of transcriptome data. ( G ) Quantification of the qPCR analysis results of inflammation biomarker-related gene expression in ACACA depleted DU145 cells. ( H ) Quantification of qPCR analysis results of inflammation biomarker-related gene expression in DU145 cells after TOFA treatment (10 µg/mL, 72 h). Data are represented as mean ± SD in ( G and H ). * P < 0.05

Journal: Cell Communication and Signaling : CCS

Article Title: ACACA depletion activates the cPLA2–arachidonic acid–NF-κB axis to drive inflammatory reprogramming in androgen receptor-independent prostate cancer

doi: 10.1186/s12964-025-02363-0

Figure Lengend Snippet: Depletion of ACACA promotes inflammation in ARIPC cells. ( A-B ) Inflammatory pathways significantly enriched in ACACA-depleted ARIPC cells. ( C-D ) GSEA showed that the ‘Regulation of inflammatory response’ was activated in ACACA-depleted ARIPC cells on the basis of the transcriptome data. ( E-F ) Heatmap of inflammatory biomarker-related gene expression in ACACA-depleted ARIPC cells on the basis of transcriptome data. ( G ) Quantification of the qPCR analysis results of inflammation biomarker-related gene expression in ACACA depleted DU145 cells. ( H ) Quantification of qPCR analysis results of inflammation biomarker-related gene expression in DU145 cells after TOFA treatment (10 µg/mL, 72 h). Data are represented as mean ± SD in ( G and H ). * P < 0.05

Article Snippet: The human androgen receptor-independent prostate cancer (ARIPC) cell lines DU145 and PC3, the androgen receptor positive prostate cancer cell line LNCaP, the benign prostatic hyperplasia cell line BPH1, and HEK293T cells were obtained from the American Type Culture Collection (ATCC, Manassas, USA).

Techniques: Biomarker Discovery, Gene Expression

ACACA depletion activates NF-κB signaling in ARIPC cells. ( A ) Western blot analysis of key proteins of the NF-κB signaling pathway and inflammatory signaling in ACACA-depleted DU145 cells. ( B-C ) Western blot analysis of P65 and pP65 after treatment with TOFA for 72 h at the indicated concentrations (µg/mL) in the indicated ARIPC cells. ( D ) and ( E ) Western blot analysis of P65 and pP65 expression following ACACA silencing in the indicated ARIPC cells. ( F-I ) Immunofluorescence analysis of P65 in ACACA-depleted DU145 cells generated with different shRNA sequences (shACACA#1 and shACACA#2), with the quantification presented in ( G ) and ( I ), respectively. ( J-K ) Immunofluorescence analysis of P65 in DU145 cells after TOFA treatment (72 h), with quantification presented in ( K ). ( L ) Western blot analysis of P65 and pP65 and ( M ) qPCR analysis of P65 after arachidonic acid (AA) treatment (50 µM, 72 h). ( N ) Western blot analysis of P65 and pP65 and ( M ) qPCR analysis of P65 after cPLA2 silencing in ACACA-depleted DU145 cells. ( O ) qPCR analysis of P65. Data are presented as the means ± SD in ( G, I, K, M, O ). * P < 0.05

Journal: Cell Communication and Signaling : CCS

Article Title: ACACA depletion activates the cPLA2–arachidonic acid–NF-κB axis to drive inflammatory reprogramming in androgen receptor-independent prostate cancer

doi: 10.1186/s12964-025-02363-0

Figure Lengend Snippet: ACACA depletion activates NF-κB signaling in ARIPC cells. ( A ) Western blot analysis of key proteins of the NF-κB signaling pathway and inflammatory signaling in ACACA-depleted DU145 cells. ( B-C ) Western blot analysis of P65 and pP65 after treatment with TOFA for 72 h at the indicated concentrations (µg/mL) in the indicated ARIPC cells. ( D ) and ( E ) Western blot analysis of P65 and pP65 expression following ACACA silencing in the indicated ARIPC cells. ( F-I ) Immunofluorescence analysis of P65 in ACACA-depleted DU145 cells generated with different shRNA sequences (shACACA#1 and shACACA#2), with the quantification presented in ( G ) and ( I ), respectively. ( J-K ) Immunofluorescence analysis of P65 in DU145 cells after TOFA treatment (72 h), with quantification presented in ( K ). ( L ) Western blot analysis of P65 and pP65 and ( M ) qPCR analysis of P65 after arachidonic acid (AA) treatment (50 µM, 72 h). ( N ) Western blot analysis of P65 and pP65 and ( M ) qPCR analysis of P65 after cPLA2 silencing in ACACA-depleted DU145 cells. ( O ) qPCR analysis of P65. Data are presented as the means ± SD in ( G, I, K, M, O ). * P < 0.05

Article Snippet: The human androgen receptor-independent prostate cancer (ARIPC) cell lines DU145 and PC3, the androgen receptor positive prostate cancer cell line LNCaP, the benign prostatic hyperplasia cell line BPH1, and HEK293T cells were obtained from the American Type Culture Collection (ATCC, Manassas, USA).

Techniques: Western Blot, Expressing, Immunofluorescence, Generated, shRNA

Depletion of ACACA causes increased arachidonic acid activity in prostate cancer cells. ( A ) Levels of two metabolites associated with arachidonic acid from metabolomic analysis data after ACACA knockdown in DU145 cells. ( B-M ) Heatmap and individual panels of arachidonic acid and its metabolite levels in ACACA-depleted PC3 cells. ( N-O ) Heatmaps showing the transcriptional expression levels of arachidonic acid pathway metabolic enzymes in the indicated ARIPC cells. ( P-Q ) Indicated pathways significantly enriched in ACACA-depleted DU145 cells. Data are represented as mean ± SD in ( A , C-M ). * P < 0.05

Journal: Cell Communication and Signaling : CCS

Article Title: ACACA depletion activates the cPLA2–arachidonic acid–NF-κB axis to drive inflammatory reprogramming in androgen receptor-independent prostate cancer

doi: 10.1186/s12964-025-02363-0

Figure Lengend Snippet: Depletion of ACACA causes increased arachidonic acid activity in prostate cancer cells. ( A ) Levels of two metabolites associated with arachidonic acid from metabolomic analysis data after ACACA knockdown in DU145 cells. ( B-M ) Heatmap and individual panels of arachidonic acid and its metabolite levels in ACACA-depleted PC3 cells. ( N-O ) Heatmaps showing the transcriptional expression levels of arachidonic acid pathway metabolic enzymes in the indicated ARIPC cells. ( P-Q ) Indicated pathways significantly enriched in ACACA-depleted DU145 cells. Data are represented as mean ± SD in ( A , C-M ). * P < 0.05

Article Snippet: The human androgen receptor-independent prostate cancer (ARIPC) cell lines DU145 and PC3, the androgen receptor positive prostate cancer cell line LNCaP, the benign prostatic hyperplasia cell line BPH1, and HEK293T cells were obtained from the American Type Culture Collection (ATCC, Manassas, USA).

Techniques: Activity Assay, Knockdown, Expressing

cPLA2-driven arachidonic acid (AA) promotes inflammation and migration in ACACA-depleted ARIPC cells. ( A ) qPCR analysis of inflammation biomarker-related gene expression in ACACA-depleted DU145 cells after 72 h of treatment with 50 µM AA. ( B-E ) Evaluation of the migration potential of ACACA-depleted DU145 cells following AA treatment (72 h) at the indicated concentrations, via wound healing ( B ) and Transwell assays ( D ), with the quantification presented in ( C ) and ( E ), respectively. ( F ) Transcriptome data and ( G ) Western blot analysis of cPLA2 expression in ACACA-depleted DU145 cells. ( H ) Correlation analysis between cPLA2 and ACACA expression levels in the SU2C PolyA cohort. ( I ) Violin plots illustrating cPLA2 expression levels in mCRPC samples divided into high and low ACACA expression groups in the SU2C PolyA cohort. ( J ) qPCR analysis of cPLA2 expression after 72 h of treatment with silencing RNA in ACACA-depleted DU145 cells. ( K ) AA concentration measured by ELISA following cPLA2 silencing for 72 h in ACACA-depleted DU145 cells. ( L ) qPCR analysis of inflammation biomarker-related gene expression after cPLA2 silencing in ACACA-depleted DU145 cells. ( M-P ) Evaluation of the migration potential of ACACA-depleted ARIPC cells after cPLA2 silencing via wound healing ( M ) and Transwell ( O ) assays, with the quantification presented in ( N ) and ( P ), respectively. The data are presented as the means ± SDs in A, C, E, F, I, J-L, N , and P. * P < 0.05

Journal: Cell Communication and Signaling : CCS

Article Title: ACACA depletion activates the cPLA2–arachidonic acid–NF-κB axis to drive inflammatory reprogramming in androgen receptor-independent prostate cancer

doi: 10.1186/s12964-025-02363-0

Figure Lengend Snippet: cPLA2-driven arachidonic acid (AA) promotes inflammation and migration in ACACA-depleted ARIPC cells. ( A ) qPCR analysis of inflammation biomarker-related gene expression in ACACA-depleted DU145 cells after 72 h of treatment with 50 µM AA. ( B-E ) Evaluation of the migration potential of ACACA-depleted DU145 cells following AA treatment (72 h) at the indicated concentrations, via wound healing ( B ) and Transwell assays ( D ), with the quantification presented in ( C ) and ( E ), respectively. ( F ) Transcriptome data and ( G ) Western blot analysis of cPLA2 expression in ACACA-depleted DU145 cells. ( H ) Correlation analysis between cPLA2 and ACACA expression levels in the SU2C PolyA cohort. ( I ) Violin plots illustrating cPLA2 expression levels in mCRPC samples divided into high and low ACACA expression groups in the SU2C PolyA cohort. ( J ) qPCR analysis of cPLA2 expression after 72 h of treatment with silencing RNA in ACACA-depleted DU145 cells. ( K ) AA concentration measured by ELISA following cPLA2 silencing for 72 h in ACACA-depleted DU145 cells. ( L ) qPCR analysis of inflammation biomarker-related gene expression after cPLA2 silencing in ACACA-depleted DU145 cells. ( M-P ) Evaluation of the migration potential of ACACA-depleted ARIPC cells after cPLA2 silencing via wound healing ( M ) and Transwell ( O ) assays, with the quantification presented in ( N ) and ( P ), respectively. The data are presented as the means ± SDs in A, C, E, F, I, J-L, N , and P. * P < 0.05

Article Snippet: The human androgen receptor-independent prostate cancer (ARIPC) cell lines DU145 and PC3, the androgen receptor positive prostate cancer cell line LNCaP, the benign prostatic hyperplasia cell line BPH1, and HEK293T cells were obtained from the American Type Culture Collection (ATCC, Manassas, USA).

Techniques: Migration, Biomarker Discovery, Gene Expression, Western Blot, Expressing, Concentration Assay, Enzyme-linked Immunosorbent Assay

The NF-κB signaling pathway was enriched in ACACA-depleted ARIPC cells. ( A-B ) GSEA-derived significant pathways in KEGG signaling transduction identified from transcriptome data of ACACA-depleted ARIPC cells. ( C ) Venn diagram of KEGG signaling transduction pathways in ACACA-depleted DU145 and PC3 cells. The intersection indicates the number of shared pathways. ( D-E ) Heatmap of the expression of key genes associated with the intersecting pathways in ( C ). ( F ) Venn diagram illustrating the overlapping genes between the DU145 ( D ) and PC3 ( E ) cell lines. ( G-H ) NF-κB-related pathways significantly enriched in ACACA-depleted ARIPC cells. ( I ) UMAP plots of single-cell RNA sequencing (scRNA-seq) data from 6 metastatic prostate cancer patients after ARSI treatment ( GSE137829 ), with luminal epithelial cells highlighted by a black circle for subsequent analysis. ( J ) UMAP plots of luminal epithelial cells in ( I ) clustered into AR-positive and AR-negative subpopulations on the basis of the GSVA score. ( K ) UMAP plots of AR-negative cells in ( J ), which were further clustered into ACACA-high ( n = 91) and ACACA-low ( n = 285) subpopulations on the basis of mRNA expression. ( L ) GO enrichment analysis of DEGs between the ACACA-high and ACACA-low subpopulations in ( K ) revealed significant enrichment of the NF-κB and TNF signaling pathways

Journal: Cell Communication and Signaling : CCS

Article Title: ACACA depletion activates the cPLA2–arachidonic acid–NF-κB axis to drive inflammatory reprogramming in androgen receptor-independent prostate cancer

doi: 10.1186/s12964-025-02363-0

Figure Lengend Snippet: The NF-κB signaling pathway was enriched in ACACA-depleted ARIPC cells. ( A-B ) GSEA-derived significant pathways in KEGG signaling transduction identified from transcriptome data of ACACA-depleted ARIPC cells. ( C ) Venn diagram of KEGG signaling transduction pathways in ACACA-depleted DU145 and PC3 cells. The intersection indicates the number of shared pathways. ( D-E ) Heatmap of the expression of key genes associated with the intersecting pathways in ( C ). ( F ) Venn diagram illustrating the overlapping genes between the DU145 ( D ) and PC3 ( E ) cell lines. ( G-H ) NF-κB-related pathways significantly enriched in ACACA-depleted ARIPC cells. ( I ) UMAP plots of single-cell RNA sequencing (scRNA-seq) data from 6 metastatic prostate cancer patients after ARSI treatment ( GSE137829 ), with luminal epithelial cells highlighted by a black circle for subsequent analysis. ( J ) UMAP plots of luminal epithelial cells in ( I ) clustered into AR-positive and AR-negative subpopulations on the basis of the GSVA score. ( K ) UMAP plots of AR-negative cells in ( J ), which were further clustered into ACACA-high ( n = 91) and ACACA-low ( n = 285) subpopulations on the basis of mRNA expression. ( L ) GO enrichment analysis of DEGs between the ACACA-high and ACACA-low subpopulations in ( K ) revealed significant enrichment of the NF-κB and TNF signaling pathways

Article Snippet: The human androgen receptor-independent prostate cancer (ARIPC) cell lines DU145 and PC3, the androgen receptor positive prostate cancer cell line LNCaP, the benign prostatic hyperplasia cell line BPH1, and HEK293T cells were obtained from the American Type Culture Collection (ATCC, Manassas, USA).

Techniques: Derivative Assay, Transduction, Expressing, RNA Sequencing, Protein-Protein interactions

Inhibition of NF-κB suppresses inflammation and migration in ACACA-depleted ARIPC cells. ( A ) Western blot analysis of key proteins in the NF-κB signaling pathway and inflammatory signaling pathway after treatment with QNZ (10 nM, 72 h) in ACACA-depleted DU145 cells. ( B ) qPCR analysis of inflammation-related genes after treatment with QNZ (10 nM, 72 h) in ACACA-depleted DU145 cells. ( C-F ) Evaluation of the migration potential of ACACA-depleted ARIPC cells following treatment with QNZ (10 nM, 72 h) via wound healing ( C ) and Transwell ( E ) assays, with the quantification presented in ( D ) and ( F ), respectively. ( G ) qPCR analysis of Slug and Sanil in ACACA-depleted DU145 cells. ( H ) qPCR analysis of Slug and Sanil in the ACACA-depleted DU145 cells after treatment with QNZ (10 nM, 72 h). The data are presented as the means ± SD in ( B, D, F, G, H ). * P < 0.05

Journal: Cell Communication and Signaling : CCS

Article Title: ACACA depletion activates the cPLA2–arachidonic acid–NF-κB axis to drive inflammatory reprogramming in androgen receptor-independent prostate cancer

doi: 10.1186/s12964-025-02363-0

Figure Lengend Snippet: Inhibition of NF-κB suppresses inflammation and migration in ACACA-depleted ARIPC cells. ( A ) Western blot analysis of key proteins in the NF-κB signaling pathway and inflammatory signaling pathway after treatment with QNZ (10 nM, 72 h) in ACACA-depleted DU145 cells. ( B ) qPCR analysis of inflammation-related genes after treatment with QNZ (10 nM, 72 h) in ACACA-depleted DU145 cells. ( C-F ) Evaluation of the migration potential of ACACA-depleted ARIPC cells following treatment with QNZ (10 nM, 72 h) via wound healing ( C ) and Transwell ( E ) assays, with the quantification presented in ( D ) and ( F ), respectively. ( G ) qPCR analysis of Slug and Sanil in ACACA-depleted DU145 cells. ( H ) qPCR analysis of Slug and Sanil in the ACACA-depleted DU145 cells after treatment with QNZ (10 nM, 72 h). The data are presented as the means ± SD in ( B, D, F, G, H ). * P < 0.05

Article Snippet: The human androgen receptor-independent prostate cancer (ARIPC) cell lines DU145 and PC3, the androgen receptor positive prostate cancer cell line LNCaP, the benign prostatic hyperplasia cell line BPH1, and HEK293T cells were obtained from the American Type Culture Collection (ATCC, Manassas, USA).

Techniques: Inhibition, Migration, Western Blot