|
ATCC
human androgen receptor independent prostate cancer aripc cell lines du145 ![]() Human Androgen Receptor Independent Prostate Cancer Aripc Cell Lines Du145, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+androgen+receptor/pmc12291313-35-1-35?v=ATCC Average 99 stars, based on 1 article reviews
human androgen receptor independent prostate cancer aripc cell lines du145 - by Bioz Stars,
2026-07
99/100 stars
|
Buy from Supplier |
|
OriGene
flag tagged wt ar ![]() Flag Tagged Wt Ar, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+androgen+receptor/pm40490871-212-9-12?v=OriGene Average 93 stars, based on 1 article reviews
flag tagged wt ar - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
|
OriGene
androgen receptor ar ![]() Androgen Receptor Ar, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+androgen+receptor/pmc12125945-53-0-13?v=OriGene Average 93 stars, based on 1 article reviews
androgen receptor ar - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
|
INDIGO Biosciences
human androgen receptor (nr3c4, ar) assay system ![]() Human Androgen Receptor (Nr3c4, Ar) Assay System, supplied by INDIGO Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+androgen+receptor/pm40239649-477-74-85?v=INDIGO+Biosciences Average 90 stars, based on 1 article reviews
human androgen receptor (nr3c4, ar) assay system - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Brinkmann Instruments
human androgen receptor ![]() Human Androgen Receptor, supplied by Brinkmann Instruments, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+androgen+receptor/pm40231807-442-27-21?v=Brinkmann+Instruments Average 90 stars, based on 1 article reviews
human androgen receptor - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
human ar ![]() Human Ar, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+androgen+receptor/pm40265585-785-6-11?v=Cell+Signaling+Technology+Inc Average 96 stars, based on 1 article reviews
human ar - by Bioz Stars,
2026-07
96/100 stars
|
Buy from Supplier |
|
OriGene
paper n a mouse ar region 2 ar2 rp gatatatgcccaggagaggtattg ![]() Paper N A Mouse Ar Region 2 Ar2 Rp Gatatatgcccaggagaggtattg, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+androgen+receptor/pmc11224269__41467_2024_49978_MOESM1_ESM-130-174-191?v=OriGene Average 92 stars, based on 1 article reviews
paper n a mouse ar region 2 ar2 rp gatatatgcccaggagaggtattg - by Bioz Stars,
2026-07
92/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
rabbit anti-human androgen receptor (ar; 1:1,000 in 5% bsa) (d6f11) ![]() Rabbit Anti Human Androgen Receptor (Ar; 1:1,000 In 5% Bsa) (D6f11), supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+androgen+receptor/10__1249_slash_mss__0000000000003509-151-91-92?v=Cell+Signaling+Technology+Inc Average 90 stars, based on 1 article reviews
rabbit anti-human androgen receptor (ar; 1:1,000 in 5% bsa) (d6f11) - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
rabbit anti human androgen receptor ![]() Rabbit Anti Human Androgen Receptor, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+androgen+receptor/10__1249_slash_mss__0000000000003509-151-82-92?v=Cell+Signaling+Technology+Inc Average 93 stars, based on 1 article reviews
rabbit anti human androgen receptor - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
|
Databank Inc
3d structure of the human androgen receptor ligand binding ![]() 3d Structure Of The Human Androgen Receptor Ligand Binding, supplied by Databank Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+androgen+receptor/10__62110_slash_sciencein__jmc__2024__685-38-4-17?v=Databank+Inc Average 90 stars, based on 1 article reviews
3d structure of the human androgen receptor ligand binding - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
Journal: Cell Communication and Signaling : CCS
Article Title: ACACA depletion activates the cPLA2–arachidonic acid–NF-κB axis to drive inflammatory reprogramming in androgen receptor-independent prostate cancer
doi: 10.1186/s12964-025-02363-0
Figure Lengend Snippet: Depletion of ACACA promotes inflammation in ARIPC cells. ( A-B ) Inflammatory pathways significantly enriched in ACACA-depleted ARIPC cells. ( C-D ) GSEA showed that the ‘Regulation of inflammatory response’ was activated in ACACA-depleted ARIPC cells on the basis of the transcriptome data. ( E-F ) Heatmap of inflammatory biomarker-related gene expression in ACACA-depleted ARIPC cells on the basis of transcriptome data. ( G ) Quantification of the qPCR analysis results of inflammation biomarker-related gene expression in ACACA depleted DU145 cells. ( H ) Quantification of qPCR analysis results of inflammation biomarker-related gene expression in DU145 cells after TOFA treatment (10 µg/mL, 72 h). Data are represented as mean ± SD in ( G and H ). * P < 0.05
Article Snippet: The
Techniques: Biomarker Discovery, Gene Expression
Journal: Cell Communication and Signaling : CCS
Article Title: ACACA depletion activates the cPLA2–arachidonic acid–NF-κB axis to drive inflammatory reprogramming in androgen receptor-independent prostate cancer
doi: 10.1186/s12964-025-02363-0
Figure Lengend Snippet: ACACA depletion activates NF-κB signaling in ARIPC cells. ( A ) Western blot analysis of key proteins of the NF-κB signaling pathway and inflammatory signaling in ACACA-depleted DU145 cells. ( B-C ) Western blot analysis of P65 and pP65 after treatment with TOFA for 72 h at the indicated concentrations (µg/mL) in the indicated ARIPC cells. ( D ) and ( E ) Western blot analysis of P65 and pP65 expression following ACACA silencing in the indicated ARIPC cells. ( F-I ) Immunofluorescence analysis of P65 in ACACA-depleted DU145 cells generated with different shRNA sequences (shACACA#1 and shACACA#2), with the quantification presented in ( G ) and ( I ), respectively. ( J-K ) Immunofluorescence analysis of P65 in DU145 cells after TOFA treatment (72 h), with quantification presented in ( K ). ( L ) Western blot analysis of P65 and pP65 and ( M ) qPCR analysis of P65 after arachidonic acid (AA) treatment (50 µM, 72 h). ( N ) Western blot analysis of P65 and pP65 and ( M ) qPCR analysis of P65 after cPLA2 silencing in ACACA-depleted DU145 cells. ( O ) qPCR analysis of P65. Data are presented as the means ± SD in ( G, I, K, M, O ). * P < 0.05
Article Snippet: The
Techniques: Western Blot, Expressing, Immunofluorescence, Generated, shRNA
Journal: Cell Communication and Signaling : CCS
Article Title: ACACA depletion activates the cPLA2–arachidonic acid–NF-κB axis to drive inflammatory reprogramming in androgen receptor-independent prostate cancer
doi: 10.1186/s12964-025-02363-0
Figure Lengend Snippet: Depletion of ACACA causes increased arachidonic acid activity in prostate cancer cells. ( A ) Levels of two metabolites associated with arachidonic acid from metabolomic analysis data after ACACA knockdown in DU145 cells. ( B-M ) Heatmap and individual panels of arachidonic acid and its metabolite levels in ACACA-depleted PC3 cells. ( N-O ) Heatmaps showing the transcriptional expression levels of arachidonic acid pathway metabolic enzymes in the indicated ARIPC cells. ( P-Q ) Indicated pathways significantly enriched in ACACA-depleted DU145 cells. Data are represented as mean ± SD in ( A , C-M ). * P < 0.05
Article Snippet: The
Techniques: Activity Assay, Knockdown, Expressing
Journal: Cell Communication and Signaling : CCS
Article Title: ACACA depletion activates the cPLA2–arachidonic acid–NF-κB axis to drive inflammatory reprogramming in androgen receptor-independent prostate cancer
doi: 10.1186/s12964-025-02363-0
Figure Lengend Snippet: cPLA2-driven arachidonic acid (AA) promotes inflammation and migration in ACACA-depleted ARIPC cells. ( A ) qPCR analysis of inflammation biomarker-related gene expression in ACACA-depleted DU145 cells after 72 h of treatment with 50 µM AA. ( B-E ) Evaluation of the migration potential of ACACA-depleted DU145 cells following AA treatment (72 h) at the indicated concentrations, via wound healing ( B ) and Transwell assays ( D ), with the quantification presented in ( C ) and ( E ), respectively. ( F ) Transcriptome data and ( G ) Western blot analysis of cPLA2 expression in ACACA-depleted DU145 cells. ( H ) Correlation analysis between cPLA2 and ACACA expression levels in the SU2C PolyA cohort. ( I ) Violin plots illustrating cPLA2 expression levels in mCRPC samples divided into high and low ACACA expression groups in the SU2C PolyA cohort. ( J ) qPCR analysis of cPLA2 expression after 72 h of treatment with silencing RNA in ACACA-depleted DU145 cells. ( K ) AA concentration measured by ELISA following cPLA2 silencing for 72 h in ACACA-depleted DU145 cells. ( L ) qPCR analysis of inflammation biomarker-related gene expression after cPLA2 silencing in ACACA-depleted DU145 cells. ( M-P ) Evaluation of the migration potential of ACACA-depleted ARIPC cells after cPLA2 silencing via wound healing ( M ) and Transwell ( O ) assays, with the quantification presented in ( N ) and ( P ), respectively. The data are presented as the means ± SDs in A, C, E, F, I, J-L, N , and P. * P < 0.05
Article Snippet: The
Techniques: Migration, Biomarker Discovery, Gene Expression, Western Blot, Expressing, Concentration Assay, Enzyme-linked Immunosorbent Assay
Journal: Cell Communication and Signaling : CCS
Article Title: ACACA depletion activates the cPLA2–arachidonic acid–NF-κB axis to drive inflammatory reprogramming in androgen receptor-independent prostate cancer
doi: 10.1186/s12964-025-02363-0
Figure Lengend Snippet: The NF-κB signaling pathway was enriched in ACACA-depleted ARIPC cells. ( A-B ) GSEA-derived significant pathways in KEGG signaling transduction identified from transcriptome data of ACACA-depleted ARIPC cells. ( C ) Venn diagram of KEGG signaling transduction pathways in ACACA-depleted DU145 and PC3 cells. The intersection indicates the number of shared pathways. ( D-E ) Heatmap of the expression of key genes associated with the intersecting pathways in ( C ). ( F ) Venn diagram illustrating the overlapping genes between the DU145 ( D ) and PC3 ( E ) cell lines. ( G-H ) NF-κB-related pathways significantly enriched in ACACA-depleted ARIPC cells. ( I ) UMAP plots of single-cell RNA sequencing (scRNA-seq) data from 6 metastatic prostate cancer patients after ARSI treatment ( GSE137829 ), with luminal epithelial cells highlighted by a black circle for subsequent analysis. ( J ) UMAP plots of luminal epithelial cells in ( I ) clustered into AR-positive and AR-negative subpopulations on the basis of the GSVA score. ( K ) UMAP plots of AR-negative cells in ( J ), which were further clustered into ACACA-high ( n = 91) and ACACA-low ( n = 285) subpopulations on the basis of mRNA expression. ( L ) GO enrichment analysis of DEGs between the ACACA-high and ACACA-low subpopulations in ( K ) revealed significant enrichment of the NF-κB and TNF signaling pathways
Article Snippet: The
Techniques: Derivative Assay, Transduction, Expressing, RNA Sequencing, Protein-Protein interactions
Journal: Cell Communication and Signaling : CCS
Article Title: ACACA depletion activates the cPLA2–arachidonic acid–NF-κB axis to drive inflammatory reprogramming in androgen receptor-independent prostate cancer
doi: 10.1186/s12964-025-02363-0
Figure Lengend Snippet: Inhibition of NF-κB suppresses inflammation and migration in ACACA-depleted ARIPC cells. ( A ) Western blot analysis of key proteins in the NF-κB signaling pathway and inflammatory signaling pathway after treatment with QNZ (10 nM, 72 h) in ACACA-depleted DU145 cells. ( B ) qPCR analysis of inflammation-related genes after treatment with QNZ (10 nM, 72 h) in ACACA-depleted DU145 cells. ( C-F ) Evaluation of the migration potential of ACACA-depleted ARIPC cells following treatment with QNZ (10 nM, 72 h) via wound healing ( C ) and Transwell ( E ) assays, with the quantification presented in ( D ) and ( F ), respectively. ( G ) qPCR analysis of Slug and Sanil in ACACA-depleted DU145 cells. ( H ) qPCR analysis of Slug and Sanil in the ACACA-depleted DU145 cells after treatment with QNZ (10 nM, 72 h). The data are presented as the means ± SD in ( B, D, F, G, H ). * P < 0.05
Article Snippet: The
Techniques: Inhibition, Migration, Western Blot